staramr (*AMR) scans bacterial genome contigs against the ResFinder, PointFinder, and PlasmidFinder databases (used by the ResFinder webservice and other webservices offered by the Center for Genomic Epidemiology) and compiles a summary report of detected antimicrobial resistance genes. The star|* in staramr indicates that it can handle all of the ResFinder, PointFinder, and PlasmidFinder databases.
Note: The predicted phenotypes/drug resistances are for microbiological resistance and not clinical resistance. This is provided with support from the NARMS/CIPARS Molecular Working Group and is continually being improved. A small comparison between phenotype/drug resistance predictions produced by staramr and those available from NCBI can be found in the tutorial. We welcome any feedback or suggestions.
For example:
staramr search -o out --pointfinder-organism salmonella *.fasta
out/summary.tsv:
| Isolate ID | Quality Module | Genotype | Predicted Phenotype | Plasmid | Scheme | Sequence Type | Genome Length | N50 value | Number of Contigs Greater Than Or Equal To 300 bp | Quality Module Feedback |
|---|---|---|---|---|---|---|---|---|---|---|
| SRR1952908 | Passed | aadA1, aadA2, blaTEM-57, cmlA1, gyrA (S83Y), sul3, tet(A) | streptomycin, ampicillin, chloramphenicol, ciprofloxacin I/R, nalidixic acid, sulfisoxazole, tetracycline | ColpVC, IncFIB(S), IncFII(S), IncI1 | senterica | 11 | 4796082 | 225419 | 59 | |
| SRR1952926 | Passed | blaTEM-57, gyrA (S83Y), tet(A) | ampicillin, ciprofloxacin I/R, nalidixic acid, tetracycline | ColpVC, IncFIB(S), IncFII(S), IncI1 | senterica | 11 | 4794071 | 225380 | 50 |
out/detailed_summary.tsv:
| Isolate ID | Data | Data Type | Predicted Phenotype | %Identity | %Overlap | HSP Length/Total Length | Contig | Start | End | Accession |
|---|---|---|---|---|---|---|---|---|---|---|
| SRR1952908 | ST11 (senterica) | MLST | ||||||||
| SRR1952908 | ColpVC | Plasmid | 98.96 | 100 | 193/193 | contig00038 | 1618 | 1426 | JX133088 | |
| SRR1952908 | aadA1 | Resistance | streptomycin | 100 | 100 | 792/792 | contig00030 | 5355 | 4564 | JQ414041 |
out/resfinder.tsv:
| Isolate ID | Gene | Predicted Phenotype | %Identity | %Overlap | HSP Length/Total Length | Contig | Start | End | Accession | Sequence |
|---|---|---|---|---|---|---|---|---|---|---|
| SRR1952908 | sul3 | sulfisoxazole | 100 | 100 | 792/792 | contig00030 | 2091 | 2882 | AJ459418 | ATGA |
| SRR1952908 | tet(A) | tetracycline | 99.92 | 97.8 | 1247/1275 | contig00032 | 1476 | 2722 | AF534183 | ATGT |
out/pointfinder.tsv:
| Isolate ID | Gene | Predicted Phenotype | Type | Position | Mutation | %Identity | %Overlap | HSP Length/Total Length | Contig | Start | End |
|---|---|---|---|---|---|---|---|---|---|---|---|
| SRR1952908 | gyrA (S83Y) | ciprofloxacin I/R, nalidixic acid | codon | 83 | TCC -> TAC (S -> Y) | 99.96 | 100.00 | 2637/2637 | contig00008 | 22801 | 20165 |
| SRR1952926 | gyrA (S83Y) | ciprofloxacin I/R, nalidixic acid | codon | 83 | TCC -> TAC (S -> Y) | 99.96 | 100.00 | 2637/2637 | contig00011 | 157768 | 160404 |
out/plasmidfinder.tsv:
| Isolate ID | Plasmid | %Identity | %Overlap | HSP Length/Total Length | Contig | Start | End | Accession |
|---|---|---|---|---|---|---|---|---|
| SRR1952908 | ColpVC | 98.96 | 100 | 193/193 | contig00038 | 1618 | 1426 | JX133088 |
| SRR1952908 | IncFIB(S) | 98.91 | 100 | 643/643 | contig00024 | 10302 | 9660 | FN432031 |
out/mlst.tsv:
| Isolate ID | Scheme | Sequence Type | Locus 1 | Locus 2 | Locus 3 | Locus 4 | Locus 5 | Locus 6 | Locus 7 |
|---|---|---|---|---|---|---|---|---|---|
| SRR1952908 | senterica | 11 | aroC(5) | dnaN(2) | hemD(3) | hisD(7) | purE(6) | sucA(6) | thrA(11) |
| SRR1952926 | senterica | 11 | aroC(5) | dnaN(2) | hemD(3) | hisD(7) | purE(6) | sucA(6) | thrA(11) |
To search a list of contigs (in fasta format) for AMR genes using ResFinder please run:
staramr search -o out *.fastaOutput files will be located in the directory out/.
To include acquired point-mutation resistances using PointFinder, please run:
staramr search --pointfinder-organism salmonella -o out *.fastaWhere --pointfinder-organism is the specific organism you are interested in (currently only salmonella, campylobacter, enterococcus faecalis and enterococcus faecium are supported).
To specify which PlasmidFinder database to use, please run:
staramr search --plasmidfinder-database-type enterobacteriaceae -o out *.fastaWhere --plasmidfinder-database-type is the specific database type you are interested in (currently only gram_positive, enterobacteriaceae are supported). By default, both databases are used.
To specify which MLST scheme to use, please run:
staramr search -o out --mlst-scheme senterica *.fastaWhere --mlst-scheme is the specific organism you are interested in (please visit the scheme genus map to see which are available). By default, it detects the scheme automatically.
To print information about the installed databases, please run:
staramr db info
If you wish to update to the latest ResFinder, PointFinder, and PlasmidFinder databases, you may run:
staramr db update --update-defaultIf you wish to switch to specific git commits of either ResFinder, PointFinder, or PlasmidFinder databases you may also pass --resfinder-commit [COMMIT], --pointfinder-commit [COMMIT], and --plasmidfinder-commit [COMMIT].
If you have updated the ResFinder/PointFinder/PlasmidFinder databases and wish to restore to the default version, you may run:
staramr db restore-default
The easiest way to install staramr is through Bioconda (we recommend using mamba as an alternative to conda).
conda install mamba # Install mamba to make it easier to install later dependencies
mamba install -c bioconda -c conda-forge -c defaults staramr==0.7.2 pandas==1.1.5 mlst==2.19.0This will install the staramr Python package at version 0.7.2 (replace with whichever version you wish to install). Bioconda will install all necessary dependencies and databases (use pandas==1.1.5 and mlst==2.19.0 to solve issues installing the correct dependency versions). Once this is complete you can run:
staramr --helpIf you wish to use staramr in an isolated environment (in case dependencies conflict) you may alternatively install with:
conda install mamba # Install mamba to make it easier to install later dependencies
mamba create -c bioconda -c conda-forge -c defaults --name staramr staramr==0.7.2 pandas==1.1.5 mlst==2.19.0To run staramr in this case, you must first activate the environment. That is:
source activate staramr
staramr --helpYou can also install staramr from PyPI using pip:
pip install staramr
However, you will have to install the external dependencies (listed below) separately.
If you wish to make use of the latest in-development version of staramr, you may update directly from GitHub using pip:
pip install git+https://github.com/phac-nml/staramrThis will only install the Python code, you will still have to install the dependencies listed below (or run the pip command from the previously installed Bioconda environment).
Alternatively, if you wish to do development with staramr you can use a Python virtual environment (you must still install the non-Python dependencies separately).
# Clone code
git clone https://github.com/phac-nml/staramr.git
cd staramr
# Setup virtual environment
virtualenv -p /path/to/python-bin .venv
source .venv/bin/activate
# Install staramr. Use '-e' to update the install on code changes.
pip install -e .
# Now run `staramr`
staramrDue to the way we packaged the ResFinder/PointFinder/PlasmidFinder databases, the development code will not come with a default database. You must first build the database before usage. E.g.
staramr db restore-default
- Python 3.5+
- BLAST+
- Git
- MLST
Note: if you wish to use Python 3.5 you will have to install BioPython <= 1.76 as later versions no longer support Python 3.5.
By default, the ResFinder/PointFinder/PlasmidFinder genes listed in genes_to_exclude.tsv will be excluded from the final results. To pass a custom list of genes the option --exclude-genes-file can be used, where the file specified will contains a list of the sequence ids (one per line) from the ResFinder/PointFinder/PlasmidFinder databases. For example:
#gene_id
aac(6')-Iaa_1_NC_003197
ColpVC_1__JX133088
Please make sure to include #gene_id in the first line. The default exclusion list can also be disabled with --no-exclude-genes.
There are 8 different output files produced by staramr:
summary.tsv: A summary of all detected AMR genes/mutations/plasmids/sequence type in each genome, one genome per line. A series of descriptive statistics is also provided for each genome as well as feedback for whether or not the genome passes several quality metrics and if not, feedback on why the genome fails.detailed_summary.tsv: A detailed summary of all detected AMR genes/mutations/plasmids/sequence type in each genome, one gene per line.resfinder.tsv: A tabular file of each AMR gene and additional BLAST information from the ResFinder database, one gene per line.pointfinder.tsv: A tabular file of each AMR point mutation and additional BLAST information from the PointFinder database, one gene per line.plasmidfinder.tsv: A tabular file of each AMR plasmid type and additional BLAST information from the PlasmidFinder database, one plasmid type per line.mlst.tsv: A tabular file of each multi-locus sequence type (MLST) and it's corresponding locus/alleles, one genome per line.settings.txt: The command-line, database versions, and other settings used to runstaramr.results.xlsx: An Excel spreadsheet containing the previous 6 files as separate worksheets.
In addition, the directory hits/ stores fasta files of the specific blast hits.
The summary.tsv output file generated by staramr contains the following columns:
- Isolate ID: The id of the isolate/genome file(s) passed to
staramr. - Quality Module: The isolate/genome file(s) pass/fail result(s) for the quality metrics
- Genotype: The AMR genotype of the isolate.
- Predicted Phenotype: The predicted AMR phenotype (drug resistances) for the isolate.
- Plasmid: Plasmid types that were found for the isolate.
- Scheme: The MLST scheme used
- Sequence Type: The sequence type that's assigned when combining all allele types
- Genome Length: The isolate/genome file(s) genome length(s)
- N50 value: The isolate/genome file(s) N50 value(s)
- Number of Contigs Greater Than Or Equal To 300 bp: The number of contigs greater or equal to 300 base pair in the isolate/genome file(s)
- Quality Module Feedback: The isolate/genome file(s) detailed feedback for the quality metrics
| Isolate ID | Quality Module | Genotype | Predicted Phenotype | Plasmid | Scheme | Sequence Type | Genome Length | N50 value | Number of Contigs Greater Than Or Equal To 300 bp | Quality Module Feedback |
|---|---|---|---|---|---|---|---|---|---|---|
| SRR1952908 | Passed | aadA1, aadA2, blaTEM-57, cmlA1, gyrA (S83Y), sul3, tet(A) | streptomycin, ampicillin, chloramphenicol, ciprofloxacin I/R, nalidixic acid, sulfisoxazole, tetracycline | ColpVC, IncFIB(S), IncFII(S), IncI1 | senterica | 11 | 4796082 | 225419 | 59 | |
| SRR1952926 | Passed | blaTEM-57, gyrA (S83Y), tet(A) | ampicillin, ciprofloxacin I/R, nalidixic acid, tetracycline | ColpVC, IncFIB(S), IncFII(S), IncI1 | senterica | 11 | 4794071 | 225380 | 50 |
The detailed_summary.tsv output file generated by staramr contains the following columns:
- Isolate ID: The id of the isolate/genome file(s) passed to
staramr. - Data: The particular gene detected from ResFinder, PlasmidFinder, PointFinder, or the sequence type.
- Data Type: The type of gene (Resistance or Plasmid), or MLST.
- Predicted Phenotype: The predicted AMR phenotype (drug resistances) found in ResFinder/PointFinder. Plasmids will be left blank by default.
- %Identity: The % identity of the top BLAST HSP to the gene.
- %Overlap: THe % overlap of the top BLAST HSP to the gene (calculated as hsp length/total length * 100).
- HSP Length/Total Length The top BLAST HSP length over the gene total length (nucleotides).
- Contig: The contig id containing this gene.
- Start: The start of the gene (will be greater than End if on minus strand).
- End: The end of the gene.
- Accession: The accession of the gene from either ResFinder or PlasmidFinder database.
| Isolate ID | Data | Data Type | Predicted Phenotype | %Identity | %Overlap | HSP Length/Total Length | Contig | Start | End | Accession |
|---|---|---|---|---|---|---|---|---|---|---|
| SRR1952908 | ST11 (senterica) | MLST | ||||||||
| SRR1952908 | ColpVC | Plasmid | 98.96 | 100 | 193/193 | contig00038 | 1618 | 1426 | JX133088 | |
| SRR1952908 | IncFIB(S) | Plasmid | 98.91 | 100 | 643/643 | contig00024 | 10302 | 9660 | FN432031 |
The resfinder.tsv output file generated by staramr contains the following columns:
- Isolate ID: The id of the isolate/genome file(s) passed to
staramr. - Gene: The particular AMR gene detected.
- Predicted Phenotype: The predicted AMR phenotype (drug resistances) for this gene.
- %Identity: The % identity of the top BLAST HSP to the AMR gene.
- %Overlap: THe % overlap of the top BLAST HSP to the AMR gene (calculated as hsp length/total length * 100).
- HSP Length/Total Length The top BLAST HSP length over the AMR gene total length (nucleotides).
- Contig: The contig id containing this AMR gene.
- Start: The start of the AMR gene (will be greater than End if on minus strand).
- End: The end of the AMR gene.
- Accession: The accession of the AMR gene in the ResFinder database.
- Sequence: The AMR Gene sequence
| Isolate ID | Gene | Predicted Phenotype | %Identity | %Overlap | HSP Length/Total Length | Contig | Start | End | Accession | Sequence |
|---|---|---|---|---|---|---|---|---|---|---|
| SRR1952908 | sul3 | sulfisoxazole | 100 | 100 | 792/792 | contig00030 | 2091 | 2882 | AJ459418 | ATGA |
| SRR1952908 | tet(A) | tetracycline | 99.92 | 97.8 | 1247/1275 | contig00032 | 1476 | 2722 | AF534183 | ATGT |
The pointfinder.tsv output file generated by staramr contains the following columns:
- Isolate ID: The id of the isolate/genome file(s) passed to
staramr. - Gene: The particular AMR gene detected, with the point mutation within.
- Predicted Phenotype: The predicted AMR phenotype (drug resistances) for this gene.
- Type: The type of this mutation from PointFinder (either codon or nucleotide).
- Position: The position of the mutation. For codon type, the position is the codon number in the gene, for nucleotide type it is the nucleotide number.
- Mutation: The particular mutation. For codon type lists the codon mutation, for nucleotide type lists the single nucleotide mutation.
- %Identity: The % identity of the top BLAST HSP to the AMR gene.
- %Overlap: The % overlap of the top BLAST HSP to the AMR gene (calculated as hsp length/total length * 100).
- HSP Length/Total Length The top BLAST HSP length over the AMR gene total length (nucleotides).
- Contig: The contig id containing this AMR gene.
- Start: The start of the AMR gene (will be greater than End if on minus strand).
- End: The end of the AMR gene.
| Isolate ID | Gene | Predicted Phenotype | Type | Position | Mutation | %Identity | %Overlap | HSP Length/Total Length | Contig | Start | End |
|---|---|---|---|---|---|---|---|---|---|---|---|
| SRR1952908 | gyrA (S83Y) | ciprofloxacin I/R, nalidixic acid | codon | 83 | TCC -> TAC (S -> Y) | 99.96 | 100.00 | 2637/2637 | contig00008 | 22801 | 20165 |
| SRR1952926 | gyrA (S83Y) | ciprofloxacin I/R, nalidixic acid | codon | 83 | TCC -> TAC (S -> Y) | 99.96 | 100.00 | 2637/2637 | contig00011 | 157768 | 160404 |
The plasmidfinder.tsv output file generated by staramr contains the following columns:
- Isolate ID: The id of the isolate/genome file(s) passed to
staramr. - Plasmid: The particular plasmid type detected.
- %Identity: The % identity of the top BLAST HSP to the plasmid type.
- %Overlap: The % overlap of the top BLAST HSP to the plasmid type (calculated as hsp length/total length * 100).
- HSP Length/Total Length The top BLAST HSP length over the plasmid type total length (nucleotides).
- Contig: The contig id containing this plasmid type.
- Start: The start of the plasmid type (will be greater than End if on minus strand).
- End: The end of the plasmid type.
- Accession: The accession of the plasmid type in the PlasmidFinder database.
| Isolate ID | Plasmid | %Identity | %Overlap | HSP Length/Total Length | Contig | Start | End | Accession |
|---|---|---|---|---|---|---|---|---|
| SRR1952908 | ColpVC | 98.96 | 100 | 193/193 | contig00038 | 1618 | 1426 | JX133088 |
| SRR1952908 | IncFIB(S) | 98.91 | 100 | 643/643 | contig00024 | 10302 | 9660 | FN432031 |
The mlst.tsv output file generated by staramr contains the following columns:
- Isolate ID: The id of the isolate/genome file(s) passed to
staramr. - Scheme: The scheme that
MLSThas identified. - Sequence Type: The sequence type that's assigned when combining all allele types
- Locus #: A particular locus in the specified MLST scheme.
| Isolate ID | Scheme | Sequence Type | Locus 1 | Locus 2 | Locus 3 | Locus 4 | Locus 5 | Locus 6 | Locus 7 |
|---|---|---|---|---|---|---|---|---|---|
| SRR1952908 | senterica | 11 | aroC(5) | dnaN(2) | hemD(3) | hisD(7) | purE(6) | sucA(6) | thrA(11) |
| SRR1952926 | senterica | 11 | aroC(5) | dnaN(2) | hemD(3) | hisD(7) | purE(6) | sucA(6) | thrA(11) |
The settings.txt file contains the particular settings used to run staramr.
- command_line: The command line used to run
staramr. - version: The version of
staramr. - start_time,end_time,total_minutes: The start, end, and duration for running
staramr. - resfinder_db_dir, pointfinder_db_dir, plasmidfinder_db_dir : The directory containing the ResFinder, PointFinder, and PlasmidFinder databases.
- resfinder_db_url, pointfinder_db_url, plasmidfinder_db_url: The URL to the git repository for the ResFinder, PointFinder, and PlasmidFinder databases.
- resfinder_db_commit, pointfinder_db_commit, plasmidfinder_db_commit: The git commit ids for the ResFinder, PointFinder, and PlasmidFinder databases.
- resfinder_db_date, pointfinder_db_date, plasmidfinder_db_date: The date of the git commits of the ResFinder, PointFinder, and PlasmidFinder databases.
- mlst_version: The version of
MLST. - pointfinder_gene_drug_version, resfinder_gene_drug_version: A version identifier for the gene/drug mapping table used by
staramr.
The hits/ directory contains the BLAST HSP nucleotides for the entries listed in the resfinder.tsv and pointfinder.tsv files. There are up to two files per input genome, one for ResFinder and one for PointFinder.
For example, with an input genome named SRR1952908.fasta there would be two files hits/resfinder_SRR1952908.fasta and hits/pointfinder_SRR1952908.fasta. These files contain mostly the same information as in the resfinder.tsv, pointfinder.tsv, and plasmidfinder.tsv files. Additional information is the database_gene_start and database_gene_end listing the start/end of the BLAST HSP on the AMR resistance gene from the ResFinder/PointFinder/PlasmidFinder databases.
>aadA1_3_JQ414041 isolate: SRR1952908, contig: contig00030, contig_start: 5355, contig_end: 4564, database_gene_start: 1, database_gene_end: 792, hsp/length: 792/792, pid: 100.00%, plength: 100.00%
ATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATC
GAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGC
...
A tutorial guiding you though the usage of staramr, interpreting the results, and comparing with antimicrobial resistances available on NCBI can be found at staramr tutorial.
Main staramr command. Can be used to set global options (primarily --verbose).
Searches input FASTA files for AMR genes.
Downloads and builds the ResFinder, PointFinder, and PlasmidFinder databases.
Updates an existing download of the ResFinder, PointFinder, and PlasmidFinder databases.
Prints information about an existing build of the ResFinder/PointFinder/PlasmidFinder databases.
Restores the default database for staramr.
This software is still a work-in-progress. In particular, not all organisms stored in the PointFinder database are supported (only salmonella, campylobacter are currently supported). Additionally, the predicted phenotypes are for microbiological resistance and not clinical resistance. Phenotype/drug resistance predictions are an experimental feature which is continually being improved.
staramr only works on assembled genomes and not directly on reads. A quick genome assembler you could use is Shovill. Or, you may also wish to try out the ResFinder webservice, or the command-line tools rgi or ariba which will work on sequence reads as well as genome assemblies. You may also wish to check out the CARD webservice.
Some ideas for the software were derived from the ResFinder, PointFinder, and PlasmidFinder command-line software, as well as from ABRicate and from SISTR (Salmonella In Silico Typing Resource) command-line tool .
Phenotype/drug resistance predictions are provided with support from the NARMS/CIPARS Molecular Working Group.
The Multi-locus sequence typing program is from the MLST Github.
If you find staramr useful, please cite the following paper:
Bharat A, Petkau A, Avery BP, Chen JC, Folster JP, Carson CA, Kearney A, Nadon C, Mabon P, Thiessen J, Alexander DC, Allen V, El Bailey S, Bekal S, German GJ, Haldane D, Hoang L, Chui L, Minion J, Zahariadis G, Domselaar GV, Reid-Smith RJ, Mulvey MR. Correlation between Phenotypic and In Silico Detection of Antimicrobial Resistance in Salmonella enterica in Canada Using Staramr. Microorganisms. 2022; 10(2):292. https://doi.org/10.3390/microorganisms10020292
You may also consider citing the following (databases or other resources used by staramr):
Zankari E, Hasman H, Cosentino S, Vestergaard M, Rasmussen S, Lund O, Aarestrup FM, Larsen MV. 2012. Identification of acquired antimicrobial resistance genes. J. Antimicrob. Chemother. 67:2640–2644. doi: 10.1093/jac/dks261
Zankari E, Allesøe R, Joensen KG, Cavaco LM, Lund O, Aarestrup F. PointFinder: a novel web tool for WGS-based detection of antimicrobial resistance associated with chromosomal point mutations in bacterial pathogens. J Antimicrob Chemother. 2017; 72(10): 2764–8. doi: 10.1093/jac/dkx217
Carattoli A, Zankari E, Garcia-Fernandez A, Voldby Larsen M, Lund O, Villa L, Aarestrup FM, Hasman H. PlasmidFinder and pMLST: in silico detection and typing of plasmids. Antimicrob. Agents Chemother. 2014. April 28th. doi: 10.1128/AAC.02412-14
Seemann T, MLST Github https://github.com/tseemann/mlst
Jolley KA, Bray JE and Maiden MCJ. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications [version 1; peer review: 2 approved]. Wellcome Open Res 2018, 3:124. doi: 10.12688/wellcomeopenres.14826.1
Copyright 2018 Government of Canada
Licensed under the Apache License, Version 2.0 (the "License"); you may not use this work except in compliance with the License. You may obtain a copy of the License at:
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License.






