Skip to content

Repository files navigation

GitHub top language Docker Static Badge Static Badge Static Badge

AmpliPiper


This README provides a quickstart to the pipeline: if you want to dive deeper, check out the complete_documentation.

Workflow

AmpliPiper Flowchart

Overview

AmpliPiper is a comprehensive workflow based on BASH scripting, Python and R for analyzing high-throughput amplicon sequencing data for multiple samples and loci. The pipeline performs various tasks, including raw read demultiplexing, filtering, consensus sequence reconstruction, species identification and phylogenetic analysis.

Third party programs used in the pipeline

  • Chopper for read filtering
  • amplicon_sorter.py for consensus sequence reconstruction
  • bold_api.py for species identification using the BOLD API
  • BLASTapi.py BLAST with Bio.Python for species identification
  • iqtree for maximum likelihood tree reconstruction
  • astral for concatenated tree reconstruction
  • asap for species delineation
  • MAFFT for multi-sequence alignment
  • pigz for multithreaded (de-)compression
  • GNU parallel for parallelisation
  • R for plotting and statistical analyses

All installation commands and additional Python and R package that are required are listed in setup.sh which can be found in the shell folder.

Installation

If you want to run AmpliPiper on a Linux or Windows system, you can build and use the AmpliPiper pipeline using Docker. Alternatively, you can install and execute AmpliPiper natively on UNIX systems (Linux and MacOS) with conda and mamba.

(1) Installation with Conda and Mamba

The installation of dependencies requires mamba and conda to be already installed on your system.

To install the pipeline program:

  1. Clone this repository:
    git clone https://github.com/nhmvienna/AmpliPiper.git
  2. Go to the cloned directory:
    cd AmpliPiper
  3. Run the setup script:
    bash shell/setup.sh

At the end of the installation, you will find all the needed dependencies in a folder called envs. Alternatively, the dependencies will be automatically installed the first time you run AmpliPiper.

This process may take a while and there might be problems when installing: please check TROUBLESHOOTING - Installation in the complete_documentation.

AmpliPiper runs on UNIX platforms. The installation and execution of AmpliPiper has been successfully tested on different Linux systems (Ubuntu/CentOS) and on macOS. However, ASAP does not successful compile on macOS and can thus not be executed when AmpliPiper is installed on a mac.

(2) Building from Docker image

Alternatively, it is possible to build AmpliPiper from a Docker image. A detailed description on how to install Docker and how to build AmpliPiper can be found here.

After installing all depenendcies, you should be ready to execute the shell script AmpliPiper.sh in the shell/ folder to carry out all steps in the analysis pipeline.

Usage

Input files

You need to prepare two input files to run the pipeline:

1- samples.csv: this file contains all sample names and the full paths to the FASTQ input files you are using for your analysis. It should look like this:

ON_A29_2,/media/user/projects/reads/ON_A29_2.fq.gz
ON_A30_28,/media/user/projects/reads/ON_A30_28.fq.gz
ON_A4_2h,/media/user/projects/reads/ON_A4_2h.fq.gz
ON_A5_29,/media/user/projects/reads/ON_A5_29.fq.gz
ON_A5_3,/media/user/projects/reads/ON_A5_3.fq.gz

2- primers.csv: a file containing forward and reverse primer sequences, along with length information about the loci to analyze. It should look like this:

ID,FWD,REV,SIZE
COX1,CAAGCCCTCCTAGTGCTCAA,ATGATTTTCACAAGCATACCTCAA,780
ITS,CAAGCCCTCCTAGTGCTCAA,AAGATTTCCACGAGCATACCTC,780
MATK_RBCL,GGATGATGTCTCAAGCCCTTC,TTTTCACGAGCATACCTCAATG,780
CTYB,GATGCCTCAAGCCCTCCTA,AAGATTTCCACGAGCATACCTC,780

⚠️ The species identificion with BOLD and BLAST currently only works for amplicons of (1) Cytochrome c oxidase subunit I (COX1), (2) Internal transcribed spacer (ITS) or (3) maturase K and/or ribulose 1,5-biphosphate carboxylase (MATK_RBCL). Make sure that the locus IDs in the primer files match exactly the locus names COX1, ITS or MATK_RBCL for the corresponding locus in your dataset. ⚠️

Run the pipeline

Required Arguments

  • -s or --samples: Provide the path to a CSV file containing the names and paths to the raw FASTQ files for each sample.
  • -p or --primers: Provide the path to a CSV file containing the IDs, forward and reverse sequences, and ploidy (1 for haploid, 2 for diploid) of each primer.
  • -o or --output: Specify the path to the output folder.

Optional Arguments

  • -b or --blast: Enable BLAST search for species identification. When setting this parameter, you need to provide an email address (e.g., --blast [email protected]) for using NCBI entrez to retrieve taxonomic information for the BLAST hits (default: disabled).
  • -c or --similar_consensus: Change the minimum similarity threshold (in percent) of amplicon_sorter. If the similarity of two clusters are smaller or equal to the threshold, they are considered separartely otherwise they are collapsed prior to consensus reconstruction (default: 96)
  • -e or --exclude: Provide a text file with samples and loci to exclude from the analysis. Each row should contain the ID of a sample to be excluded. Names need to be identical to the IDs in samples.csv
  • -f or --force: Force overwrite the output folder if it already exists (default: cowardly refusing to overwrite).
  • -i or --partition: Use partition model for iqtree with combined dataset. ⚠️ may take very long ⚠️ (default: disabled)
  • -k or --kthreshold: Define the threshold k for the maximum allowed proportion of mismatches for primer alignment during demultiplexing (default: 0.05).
  • -m or --minreads: Set the minimum number of reads required for consensus sequence reconstruction (default: 100).
  • -n or --nreads: Provide the absolute number or percentage of top-quality reads to consider for consensus sequence generation and variant calling (default: 500).
  • -q or --quality: Specify the minimum PHRED quality score for read filtering (default: 10).
  • -r or --sizerange: Define the allowed size buffer in basepairs around the expected locus length (default: 100).
  • -t or --threads: Specify the number of threads to be used for parallel processing (default: 10).
  • -w or --nowatermark: Remove the watermark from the tree figures
  • -y or --freqthreshold: Retain consensus sequences for further analyses which are supported by raw reads, whose frequency in the total pool of reads is larger or equal to this threshold (default: 0.1).

Example command

⚠️ In the following command, make sure to replace <path_to> with the actual path to your files ⚠️

bash <path_to>/shell/AmpliPiper.sh \
    --samples <path_to>/testdata/data/samples.csv \
    --primers <path_to/testdata/data/primers.csv \
    --output <path_to>/testdata/results/demo \
    --quality 10 \
    --nreads 1000 \
    --blast [email protected] \
    --similar_consensus 97 \
    --threads 200 \
    --kthreshold 0.05 \
    --minreads 50 \
    --sizerange 100 \
    --outgroup He_mor_41 \
    --force

This will execute the pipeline and save the output in the demo folder.

If you want to test the pipeline on a test dataset, please check out the testdata/ folder within this repository and execute the commands in the testdata/main.sh shell script.

Analysis steps

⚠️ From the 7th of November, since BOLD upgraded from v4 to v5, the API service is migrating and thus unavailable. We advise that you use, for now, BLAST and, if you do not wish to perform species identification, we suggest to change the name of the loci (for example, from COX1 to nCOX1).

  1. Demultiplexing: The pipeline uses demultiplex_fastq.py to demultiplex the raw fastq files based (1) on correct alignment of the primer sequences at the terminal ends of a raw FASTQ file and (2) on the expected length of the amplicon .
  2. Filtering: The pipeline uses Chopper to remove low-quality reads based on a PHRED-scaled quality threshold.
  3. Consensus Sequence Reconstruction: The pipeline uses amplicon_sorter.py to reconstruct consensus sequences for each locus and sample.
  4. Choice of Haplotypes: The pipeline uses ChooseConsensus.py to estimate the expected ploidy and chooses consensus haplotypes reconstructed with amplicon_sorter that match in frequency with the expected ploidy based on maximum likelihood tests.
  5. Species Identification: The pipeline uses, as a default, bold_api.py to identify species based on the BOLD API using the consensus sequences either of COX1, ITS or MATK_RBCL amplicons. There is also the possibility to use BLAST API for the same loci, by setting the --blast flag: the two species identification services are mutually exclusive.
  6. Phylogenetic Analysis: The pipeline uses iqtree to reconstruct maximum likelihood (ML) trees for each locus separately and for all loci combined. In addition, astral is used to reconstruct a concatenated tree across all loci based on the locus-specific ML-trees.
  7. Genetic Distance Calculation: The pipeline uses treedistance.py to calculate Robinson-Foulds distances between trees.
  8. Species Delineation: The pipeline uses asap to perform species delineation for each locus and the concatenated dataset (obtained with MergeAln.py).
  9. HTML Summary: The pipeline uses displayoutput.py to generate an HTML summary of the results.

Output structure

Output directory will be structured like this:

demo
├── data
│   ├── demultiplexed
│   ├── filtered
│   └── raw
├── log
│   ├── ampliconsorter
│   ├── demulti
│   ├── html
│   ├── SpecDelim
│   ├── SpecID
│   ├── summary
│   └── variantcalling
├── results
│   ├── astraltree
│   ├── consensus_seqs
│   ├── haplotypes
│   ├── html
│   ├── SpeciesDelim
│   ├── SpeciesID
│   ├── summary
|   └── tree
├── Output
│   ├── SpeciesDelim
│   ├── SpeciesID
│   ├── astraltree
│   ├── consensus_seqs
│   ├── haplotypes
│   ├── summary
│   ├── tree
|   └── results.html
└── shell
    ├── demult1
    └── demult2

You will see a summary of the results by displaying results.html in your browser, for example:

firefox testresults/Output/results.html

See the RESULTS explanation page in the complete_documentation to get a thorough breakdown of the results.

License

AMPLIPIPER is an open source project licenced under GPL3.

Acknowledgments

We wish to thank all the amazing people that supported the project and shared advice or opinions about it, as well as all the teams and people behind the software employed in our pipeline.

This project has been funded and is being developed as part of TETTRIs - Task 6.2, WP6.

tettris nhm

Releases

Packages

Used by

Contributors

Languages