DSL2: Processed reads not saved in results directory

[DeondeJager]

Check Documentation

I have checked the following places for your error:

• nf-core website: troubleshooting
• nf-core/eager pipeline documentation
  - nf-core/eager FAQ/troubleshooting can be found here

Description of the bug

Preprocessed reads are not saved in results directory, even though preprocessing_savepreprocessedreads = true in config.

Steps to reproduce

Steps to reproduce the behaviour:

1. Command line: nextflow run nf-core/eager -c $EAGER_CONFIGS/CAAMP_profiles_v3.config -profile mjolnir_globe,CAAMP_mapQ0 -r dev --max_cpus $SLURM_CPUS_PER_TASK --input $WORKDIR/Syncerus_caffer_samplesheet.tsv --fasta_sheet $WORKDIR/Syncerus_caffer_refsheet.tsv --outdir $WORKDIR/Syncerus_caffer/step1_eager
2. See error: No error message.

Expected behaviour

Preprocessed reads (fastq files) should appear in preprocessing/fastp/data.
Currently only see a preprocessing/fastp/stats directory.

Log files

Have you provided the following extra information/files:

• The command used to run the pipeline
• The .nextflow.log file
• The exact error: No error message.

System

• Hardware: HPC
• Executor: Slurm
• OS: Red Hat Enterprise Linux
• Version: 8.10 (Ootpa)

Nextflow Installation

• Version: 25.10.4

Container engine

• Engine: Singularity
• version: 3.8.7
• Image tag: not sure where to get this info, but nfcore/eager:dev I think?

Additional context

Uploaded three log files, as I think .1.log or .2.log did the actual read processing, whereas the latest .log was for a resumed run where I changed from damageprofiler to mapdamage (java heap space issues, don't worry about it here).
.nextflow.log
.nextflow.log.2.log
.nextflow.log.1.log

My custom config:

profiles {
  CAAMP_mapQ0 {
    params {
	
        // Profile description
		config_profile_description = 'This is step 1 in the Circular Assembly of Ancient Mitogenomes Pipeline (CAAMP). Parameters for circular mapping of ancient DNA reads to a concatenated reference, including the reference mitogenome (competitive mapping), using bwa aln via CircularMapper. This uses a mapping quality of 0, which is required by the next program to be used, COMFRT, which recovers reads aligned to multiple scaffolds by bwa.'
		
		config_profile_contact = 'Deon de Jager (dejager4@gmail.com)'
        
		// Params to set on the command-line (specific to species): nextflow run nf-core/eager -c $EAGER_CONFIGS/CAAMP_profiles_v3.config -profile mjolnir_globe,CAAMP_mapQ0 -r dev --max_cpus $SLURM_CPUS_PER_TASK --input $WORKDIR/Syncerus_caffer_samplesheet.tsv --fasta_sheet $WORKDIR/Syncerus_caffer_refsheet.tsv --outdir $WORKDIR/Syncerus_caffer/step1_eager
		
		// Preprocessing
		//complexity_filter_poly_g = true // Not currently a listed option in v3
		preprocessing_tool = 'fastp'
		preprocessing_excludeunmerged = true
		preprocessing_adapter1 = 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' // Standard Illumina Truseq (default)
		preprocessing_adapter2 = 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA' // Standard Illumina Truseq (default)
		preprocessing_minlength = 30
		preprocessing_savepreprocessedreads = true
		// clip_min_read_quality = 20 // Not currently a listed option in v3
		// preserve5p = true // Only for AdapterRemoval. Disables quality based trimming of collapsed reads, since both ends of these are informative for PCR duplicate filtering
		
		// Mapping
		mapping_tool = 'circularmapper'
		mapping_bwaaln_n = 0.01 // aDNA parameter (default)
		mapping_bwaaln_l = 1024 // aDNA parameter (default)
		mapping_bwaaln_o = 2 // aDNA parameter (default)
		mapping_circularmapper_circularfilter = false // Retain reads that do not map to the circular target chromosome (and also retain non-circular chromosome headers). Required for COMFRT. 
		
		// BAM Filtering
		run_bamfiltering = true // default
		bamfiltering_mappingquality = 0 // Explicitly specify a mapping quality of 0.
		bamfiltering_retainunmappedgenomicbam = true // Keep unmapped reads in bam file (I think maybe COMFRT uses them for stats).
		
		// Deduplication
		deduplication_tool = 'markduplicates'
		deduplication_skipregionsplit = true // run deduplication without splitting bams by contig.
		
		// Damage Manipulation
		run_trim_bam = false // Explicitly switch off bam trimming (this is the default). (Will only run on non-UDG or half-UDG libraries.)
		
		// (aDNA) Damage Analysis
		damagecalculation_tool = 'mapdamage' // was damageprofiler in the older two log files.
		damagecalculation_mapdamage_downsample = 500000
		
		// Feature Annotation Statistics
		run_bedtools_coverage = true // BED file for mitogenome provided in refsheet.tsv under bedtools_feature_file field
		
    }
  }
}