gen_raw_mask.pl truncating fasta file

[NicMAlexandre]

Hello,

1. I have a chromosome (Chr1) that is 196345723 bp in length.

2. psmc/utils/./splitfa Sept22Assembly.fasta 35 | split -l 20000000
   #This step produced three files and I confirmed the correct end to chromosome 1 in xaa
   #kmer fasta headers are like so

Chr1_1
AGAGTGGTGGGGACAAGGCTCAGAGCCTGAACTGA

cat xaa xab xac > xxaa
#I also confirmed the correct end to chromosome 1 in xxaa

3. bwa aln -R 1000000 -O 3 -E 3 Sept22Assembly.fasta xxaa > xxaa.sai
   bwa samse Sept22Assembly.fasta xxaa.sai xxaa > aln-se.sam

#I viewed mapped reads for Chr1 and find that there are sites mapping well up into 196000000

4. perl seqbility-20091110/gen_raw_mask.pl aln-se.sam > rawMask_35.fa

All errors propogate after this step where my chromosome size is now only 5 million bp.

I also find that all representative sites for Chr1 stop at 5609912 which is eerily similar to the last kmer fasta header for Chr1 (>Chr1_5609878).

Any help here would be greatly appreciated,

Nicolas

[NicMAlexandre]

I should note that I'm working with two other groups that have been reporting the same errors with truncation.